ZFIN ID: ZDB-MRPHLNO-060322-1
Morpholino Name: MO1-pax3a
Target: pax3a (1)
Previous Name: MO1-pax3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCTAATGCGGTCATATCTCCTCTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pax3a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pax3a
Expressed Gene Anatomy Figures
foxd3 Fig. 8 with image from Lee et al., 2006
myf5 Fig. 8 with image from Lee et al., 2006
myod1 Fig. 8 with image from Lee et al., 2006
PHENOTYPE
Phenotype resulting from MO1-pax3a
No data available

Phenotype of all Fish created by or utilizing MO1-pax3a
No data available
OTHER MO1-pax3a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)