ZFIN ID: ZDB-MRPHLNO-060127-1
Morpholino Name: MO1-crx
Target: crx (1)
Previous Name: MO4-crx (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATGTAGGACATCATTCTTGGGACGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-crx No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-crx
Expressed Gene Anatomy Figures
aanat2 Fig. 4 from Gamse et al., 2002
gngt1 Fig. 8 with image from Chen et al., 2007
nr1d1 Fig. 4 from Gamse et al., 2002
otx5 Fig. 4Fig. 5Fig. 6 from Gamse et al., 2002
rbp3 Fig. 4 from Gamse et al., 2002
rx2 Fig. 4 from Gamse et al., 2002
PHENOTYPE
Phenotype resulting from MO1-crx
Phenotype of all Fish created by or utilizing MO1-crx
Genome Resources:
CITATIONS (5)