Morpholino

MO1-med12

ID
ZDB-MRPHLNO-060125-1
Name
MO1-med12
Previous Names
  • trap230 MO (1)
Target
Sequence
5' - TCAGAACGCCGAAGGCAGCCATCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-med12
Phenotype
Phenotype resulting from MO1-med12
Phenotype of all Fish created by or utilizing MO1-med12
Citations