Morpholino

MO1-rax

ID

ZDB-MRPHLNO-060109-5

Name

MO1-rax

Previous Names

MO1-rx3
rx3ATG-MO (1)

Target

rax (1)

Sequence

5' - GAGATCCAACAAGCCTCATTGAACG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rax

No data available

Phenotype

Phenotype resulting from MO1-rax

No data available

Phenotype of all Fish created by or utilizing MO1-rax

Phenotype	Fish	Conditions	Figures
hypothalamus rax expression spatial pattern, ameliorated	WT + MO1-rax + MO3-rax	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus ab4-h3 labeling amount, ameliorated	WT + MO1-rax + MO3-rax	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus pomca expression amount, ameliorated	WT + MO1-rax + MO3-rax	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus pomca expression absent, abnormal	WT + MO1-rax + MO3-rax	control	Fig. 7 from Muthu et al., 2016
hypothalamus nkx2-1 expression spatial pattern, ameliorated	WT + MO1-rax + MO3-rax	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus etv4 expression increased amount, abnormal	WT + MO1-rax + MO3-rax	standard conditions	Fig. 5 from Muthu et al., 2016
hypothalamus mitotic cell cycle process increased occurrence, abnormal	WT + MO1-rax + MO3-rax	standard conditions	Fig. 6 , Fig. 7 from Muthu et al., 2016
hypothalamus shha expression decreased amount, abnormal	WT + MO1-rax + MO3-rax	standard conditions	Fig. 6 from Muthu et al., 2016
hypothalamus nkx2-1 expression spatial pattern, abnormal	WT + MO1-rax + MO3-rax	control	Fig. 7 from Muthu et al., 2016
hypothalamus nr5a1a expression amount, ameliorated	WT + MO1-rax + MO3-rax	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus mitotic cell cycle process occurrence, ameliorated	WT + MO1-rax + MO3-rax	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus ptch2 expression spatial pattern, abnormal	WT + MO1-rax + MO3-rax	control	Fig. 7 from Muthu et al., 2016
hypothalamus ab4-h3 labeling increased amount, abnormal	WT + MO1-rax + MO3-rax	standard conditions	Fig. 6 , Fig. 7 from Muthu et al., 2016
hypothalamus ptch2 expression spatial pattern, ameliorated	WT + MO1-rax + MO3-rax	chemical treatment: SMO receptor agonist	Fig. 7 from Muthu et al., 2016
hypothalamus nr5a1a expression absent, abnormal	WT + MO1-rax + MO3-rax	control	Fig. 7 from Muthu et al., 2016
eye aplastic, abnormal	WT + MO1-rax + MO3-rax	standard conditions	Fig. 6 from Tessmar-Raible et al., 2007
hypothalamus rax expression spatial pattern, abnormal	WT + MO1-rax + MO3-rax	control	Fig. 7 from Muthu et al., 2016

Citations