Morpholino

MO3-cxcl12a

ID
ZDB-MRPHLNO-051028-2
Name
MO3-cxcl12a
Previous Names
  • SDF-1a-1-MO (1)
Target
Sequence
5' - CTACTACGATCACTTTGAGATCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-cxcl12a
Phenotype
Phenotype resulting from MO3-cxcl12a
Phenotype of all Fish created by or utilizing MO3-cxcl12a
Phenotype Fish Conditions Figures
primordial germ cell mislocalised, abnormal er1Tg + MO3-cxcl12a standard conditions Fig. 4 with image from Boldajipour et al., 2008
cell migration involved in gastrulation delayed, abnormal ha01Tg + MO3-cxcl12a standard conditions Fig. S2 with image from Mizoguchi et al., 2008
hematopoietic system vasculature increased amount, abnormal pd27Tg ; zf741Tg + MO3-cxcl12a control Fig. 7 with image from Theodore et al., 2017
hematopoietic system posterior region has number of hematopoietic multipotent progenitor cell, ameliorated pd27Tg ; zf741Tg + MO3-cxcl12a chemical treatment by environment: MMP9 inhibitor I Fig. 7 with image from Theodore et al., 2017
hematopoietic system posterior region EGFP expression amount, ameliorated pd27Tg ; zf741Tg + MO3-cxcl12a chemical treatment by environment: MMP9 inhibitor I Fig. 7 with image from Theodore et al., 2017
hematopoietic system vasculature amount, ameliorated pd27Tg ; zf741Tg + MO3-cxcl12a chemical treatment by environment: MMP9 inhibitor I Fig. 7 with image from Theodore et al., 2017
pancreas morphology, abnormal WT + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
gut morphology, abnormal WT + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
cell migration involved in gastrulation delayed, abnormal WT + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
pancreas pancreatic B cell dispersed, abnormal WT + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
pancreas decreased size, abnormal WT + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
liver decreased size, abnormal WT + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
endodermal cell filopodium decreased amount, abnormal ha01Tg + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 6 with image from Mizoguchi et al., 2008
endodermal cell circular, abnormal ha01Tg + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 6 with image from Mizoguchi et al., 2008
gut bifurcated, abnormal ha01Tg + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
cell migration involved in gastrulation delayed, abnormal ha01Tg + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 2 with imageFig. S2 with image from Mizoguchi et al., 2008
cell migration involved in gastrulation process quality, abnormal ha01Tg + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 6 with image from Mizoguchi et al., 2008
endodermal cell filopodium orientation whole organism dorsal-ventral axis, abnormal ha01Tg + MO1-cxcl12b + MO3-cxcl12a standard conditions Fig. 6 with image from Mizoguchi et al., 2008
thymus lacks parts or has fewer parts of type lymphocyte, abnormal fr101Tg; fr103Tg + MO2-ccl25a + MO3-cxcl12a standard conditions Fig. 6 with image from Hess et al., 2012
lymphoid lineage cell migration into thymus disrupted, abnormal fr101Tg; fr103Tg + MO2-ccl25a + MO3-cxcl12a standard conditions Fig. 6 with image from Hess et al., 2012
hematopoietic stem cell migration increased process quality, abnormal mybhkz3/hkz3; la2Tg + MO3-cxcl12a standard conditions Fig. 5 from Zhang et al., 2011
Citations