Morpholino
MO1-cdh4
- ID
- ZDB-MRPHLNO-050930-2
- Name
- MO1-cdh4
- Previous Names
-
- RcadMphA (1)
- Target
- Sequence
-
5' - AAGGAGGCAGATGTTTGTTATTCAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdh4
Expressed Gene | Anatomy | Figures |
---|---|---|
alcama |
Fig. 5 ![]() |
|
cdh2 |
Fig. 8 ![]() |
|
cdh4 |
Fig. 1 ![]() Fig. 3 ![]() |
|
cdh6 |
Fig. 3 ![]() |
|
crx |
Fig. 9
from Liu et al., 2007 Fig. 6 ![]() |
|
cxcr4b |
Fig. 8 ![]() |
|
elavl3 |
Fig. 2 ![]() |
|
gnat1 |
Fig. 6,
text only
from Liu et al., 2007 |
|
gnat2 |
Fig. 6,
text only
from Liu et al., 2007 |
|
neurod1 |
Fig. 3 ![]() |
|
opn1sw1 |
Fig. 6
from Liu et al., 2007 |
|
otx5 |
Fig. 9
from Liu et al., 2007 Fig. 6 ![]() |
|
rbp3 |
Fig. 6,
text only
from Liu et al., 2007 |
|
rho |
text only
from Liu et al., 2007 |
Phenotype
Phenotype resulting from MO1-cdh4
Phenotype of all Fish created by or utilizing MO1-cdh4
Citations