ZFIN ID: ZDB-MRPHLNO-050914-1
Morpholino Name: MO1-mef2aa
Target: mef2aa (1)
Previous Names: GT-MO (1), MO1-mef2a

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTCGTTTGTGCTCACCAGAGTTGTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mef2aa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mef2aa
Expressed Gene Anatomy Figures
ihhb Fig. 4 with image from Wang et al., 2006
mef2aa Fig. 2 from Wang et al., 2005
mef2d Fig. 5 from Wang et al., 2005
myh6 Fig. 5 from Wang et al., 2005
myh7 Fig. 5 from Wang et al., 2005
myl7 Fig. 5 from Wang et al., 2005
nkx2.5 Fig. 5 from Wang et al., 2005
prdm1a Fig. 5 with image from Wang et al., 2006
ptch2 Fig. 2 with image from Wang et al., 2006
shha Fig. 4 with image from Wang et al., 2006
tbx5a Fig. 5 from Wang et al., 2005
tpma Fig. 5 from Wang et al., 2005
ttn.2 Fig. 1 with image from Wang et al., 2006
Fig. 3 from Wang et al., 2005
PHENOTYPE
Phenotype resulting from MO1-mef2aa
Phenotype of all Fish created by or utilizing MO1-mef2aa
Phenotype Fish Conditions Figures
post-vent region curved ventral, abnormal AB + MO1-mef2aa standard conditions Fig. 1 with image from Wang et al., 2006
Fig. 3 from Wang et al., 2005
muscle pioneer decreased amount, abnormal AB + MO1-mef2aa standard conditions Fig. 2 with image from Wang et al., 2006
cardiac ventricle decreased functionality, abnormal AB + MO1-mef2aa standard conditions Fig. S Movie 5Fig. S Movie1 from Wang et al., 2007
heart contraction decreased rate, abnormal AB + MO1-mef2aa standard conditions Fig. 3 from Wang et al., 2005
atrium dilated, abnormal AB + MO1-mef2aa standard conditions Fig. 3 from Wang et al., 2005
somite U-shaped, abnormal AB + MO1-mef2aa standard conditions Fig. 1 with image from Wang et al., 2006
post-vent region somite apoptotic, abnormal AB + MO1-mef2aa standard conditions Fig. 3 with image from Wang et al., 2006
sarcomere organization disrupted, abnormal AB + MO1-mef2aa standard conditions Fig. 4 from Wang et al., 2005
horizontal myoseptum aplastic, abnormal AB + MO1-mef2aa standard conditions Fig. 1 with image from Wang et al., 2006
somite border posterior region surface feature shape, abnormal AB + MO1-mef2aa standard conditions Fig. 3 from Wang et al., 2005
cardiac muscle cell myofibril disorganized, abnormal AB + MO1-mef2aa standard conditions Fig. 4 from Wang et al., 2005
somite development disrupted, abnormal AB + MO1-mef2aa standard conditions Fig. 3 from Wang et al., 2005
cardiac ventricle dilated, abnormal AB + MO1-mef2aa standard conditions Fig. 3 from Wang et al., 2005
heart contractility, abnormal AB + MO1-mef2aa standard conditions Fig. 3 from Wang et al., 2005
Genome Resources:
CITATIONS (4)