ZFIN ID: ZDB-MRPHLNO-050818-7
Morpholino Name: MO1-foxd3
Target: foxd3 (1)
Sequence:
5' - TGCTGCTGGAGCAACCCAAGGTAAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-foxd3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-foxd3
Expressed Gene Anatomy Figures
actc1b Fig. 7 with image from Lee et al., 2006
aox5 Fig. 5 with image from Lister et al., 2006
crestin Fig. 3 with image from Lister et al., 2006
dct Fig. 4 with image from Cooper et al., 2009
Fig. 5 with image from Lister et al., 2006
dlx2a Fig. 4 with image from Lister et al., 2006
ednrba Fig. 5 with image from Lister et al., 2006
egr2b Fig. S4 with image from Lister et al., 2006
foxd3 Fig. 3 with imageFig. 6 with imageFig. S1 with imageFig. S2 with image from Lister et al., 2006
gsc Fig. 4 with image from Lister et al., 2006
mbpa Fig. 7 with image from Lister et al., 2006
mitfa Fig. 4 with image from Cooper et al., 2009
Fig. S2 with image from Lister et al., 2006
myf5 Fig. 6 with imageFig. 7 with image from Lee et al., 2006
myod1 Fig. 7 with image from Lee et al., 2006
myog Fig. 7 with image from Lee et al., 2006
neurog1 Fig. 6 with image from Lister et al., 2006
phox2bb Fig. 6 with image from Lister et al., 2006
pou3f1 Fig. S4 with image from Lister et al., 2006
ret Fig. 6 with image from Lister et al., 2006
snai1b Fig. 3 with image from Lister et al., 2006
sox10 Fig. 3 with image from Lister et al., 2006
tfap2a Fig. S2 with image from Lister et al., 2006
PHENOTYPE
Phenotype resulting from MO1-foxd3
Phenotype of all Fish created by or utilizing MO1-foxd3
Genome Resources:
CITATIONS (10)