Morpholino

MO1-dnmt3bb.1

ID
ZDB-MRPHLNO-050809-6
Name
MO1-dnmt3bb.1
Previous Names
  • dnmt4-MO
Target
Sequence
5' - TTATTTCTTCCTTCCTCATCCTGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dnmt3bb.1
Phenotype
Phenotype resulting from MO1-dnmt3bb.1
Phenotype of all Fish created by or utilizing MO1-dnmt3bb.1
Phenotype Fish Conditions Figures
forerunner cell group sox17 expression spatial pattern, abnormal WT + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
forerunner cell group distributed, abnormal WT + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
forerunner cell group foxj1a expression spatial pattern, abnormal WT + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
heart tube position, abnormal WT + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
heart looping process quality, abnormal WT + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
forerunner cell group actin filament structure, abnormal s870Tg + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
forerunner cell group cdh1 expression decreased amount, abnormal s870Tg + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
forerunner cell group distributed, abnormal s870Tg + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
determination of pancreatic left/right asymmetry disrupted, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
heart jogging disrupted, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
heart tube position, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
heart looping process quality, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
determination of heart left/right asymmetry disrupted, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
pancreatic bud position, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
determination of liver left/right asymmetry disrupted, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
liver position, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
heart looping process quality, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
heart jogging disrupted, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
heart tube position, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
determination of heart left/right asymmetry disrupted, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
Citations