header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050723-4
Morpholino Name: MO1-drl
Target: drl (1)
Sequence:
5' - CAGGGTTTTGTTGTATTCTTCATCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-drl No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-drl No data available
PHENOTYPE
Phenotype resulting from MO1-drl
No data available

Phenotype of all Fish created by or utilizing MO1-drl
No data available
Genome Resources:
CITATIONS (1)