header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050503-1
Morpholino Name: MO1-her9
Target: her9 (1)
Sequence:
5' - CTCCATATTATCGGCTGGCATGATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This morpholino is designed against the start site.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-her9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-her9
Expressed Gene Anatomy Figures
atoh1a Fig. 5 with image from Bae et al., 2005
neurod4 Fig. 5 with image from Bae et al., 2005
PHENOTYPE
Phenotype resulting from MO1-her9
No data available

Phenotype of all Fish created by or utilizing MO1-her9
No data available
OTHER MO1-her9 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)