Morpholino

MO1-wnt11

ID
ZDB-MRPHLNO-050318-4
Name
MO1-wnt11
Previous Names
  • MO1-wnt11r
  • wnt11r-MO (1)
Target
Sequence
5' - AGGGAAGGTTCGCTTCATGCTGTAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino targeting the translation start site of wnt11r.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt11
No data available
Phenotype
Phenotype resulting from MO1-wnt11
Phenotype of all Fish created by or utilizing MO1-wnt11
Phenotype Fish Conditions Figures
convergent extension disrupted, abnormal AB + MO1-wnt11 standard conditions Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt11 + MO1-wnt4 standard conditions Table 2 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 standard conditions Table 2 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 standard conditions Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt11 + MO2-wnt11f2 standard conditions Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt11 + MO2-wnt11f2 standard conditions Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt11 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt11 + MO2-wnt11f2 standard conditions Table 2 from Matsui et al., 2005
intestinal bulb duplicated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Table 2 from Matsui et al., 2005
convergent extension involved in organogenesis disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Table 2 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
pancreatic bud duplicated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt11 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
heart tube bifurcated, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
whole organism apoptotic, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
Citations