ZFIN ID: ZDB-MRPHLNO-050316-3
Morpholino Name: MO2-aldh1a2
Target: aldh1a2 (1)
Previous Name: MOraldh2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCAGTTCAACTTCACTGGAGGTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-aldh1a2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-aldh1a2
Expressed Gene Anatomy Figures
dlc Fig. 6 from Li et al., 2015
egr2b Fig. S2 with image from Shimizu et al., 2006
fgf8a Fig. 6 from Li et al., 2015
hhex Fig. 5 with image from Alexa et al., 2009
hoxb1a Fig. S2 with image from Shimizu et al., 2006
hoxb4a Fig. S2 with image from Shimizu et al., 2006
hoxb5a Fig. S2 with image from Shimizu et al., 2006
hoxd4a Fig. 5 with image from Drummond et al., 2013
ins Fig. 1 with image from Stafford et al., 2006
mafba Fig. S2 with image from Shimizu et al., 2006
meis3 Fig. 5 with image from Drummond et al., 2013
myod1 Fig. 5 from Li et al., 2015
pdx1 Fig. 5 with image from Alexa et al., 2009
prox1a Fig. 5 with image from Alexa et al., 2009
PHENOTYPE
Phenotype resulting from MO2-aldh1a2
Phenotype Figures
motor nucleus of vagal nerve anatomical region decreased size, abnormal Fig. 11 with image from Drummond et al., 2013
retinoic acid receptor signaling pathway decreased process quality, abnormal Fig. 8 with image from Drummond et al., 2013

Phenotype of all Fish created by or utilizing MO2-aldh1a2
Phenotype Fish Conditions Figures
rhombomere 5 decreased distance somite 1, abnormal WT + MO1-aldh1a2 + MO2-aldh1a2 standard conditions Fig. 3 with image from Begemann et al., 2001
paraxial mesoderm development decreased process quality, abnormal WT + MO1-aldh1a2 + MO2-aldh1a2 standard conditions Fig. 3 with image from Begemann et al., 2001
motor nucleus of vagal nerve anatomical region decreased size, abnormal rw0Tg + MO2-aldh1a2 standard conditions Fig. 11 with image from Drummond et al., 2013
retinoic acid receptor signaling pathway decreased process quality, abnormal sk71Tg + MO2-aldh1a2 standard conditions Fig. 8 with image from Drummond et al., 2013
OTHER MO2-aldh1a2 MORPHOLINO PAGESNo links to external sites
CITATIONS (10)