ZFIN ID: ZDB-MRPHLNO-050308-3
Morpholino Name: MO1-ptch1
Target: ptch1 (1)
Previous Names: MO1-ptc2, ptc2 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGGAGACATTAACAGCCGAGGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a translation blocking morpholino.
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ptch1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ptch1
Expressed Gene Anatomy Figures
gli1 Fig. 5 from Chassaing et al., 2016
ptch1 Fig. 5 from Chassaing et al., 2016
PHENOTYPE
Phenotype resulting from MO1-ptch1
Phenotype of all Fish created by or utilizing MO1-ptch1
Phenotype Fish Conditions Figures
somite shape, abnormal WT + MO1-ptch1 standard conditions Fig. S3 from Chassaing et al., 2016
fast muscle cell mislocalised, abnormal WT + MO1-ptch1 standard conditions Fig. 2 from Wolff et al., 2003
whole organism ptch1 expression increased amount, abnormal WT + MO1-ptch1 standard conditions Fig. 5 from Chassaing et al., 2016
slow muscle cell mislocalised, abnormal WT + MO1-ptch1 standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell increased amount, abnormal WT + MO1-ptch1 standard conditions Fig. 2 from Wolff et al., 2003
whole organism gli1 expression increased amount, abnormal WT + MO1-ptch1 standard conditions Fig. 5 from Chassaing et al., 2016
eye decreased size, abnormal WT + MO1-ptch1 standard conditions Fig. 3 from Chassaing et al., 2016
fast muscle cell increased amount, abnormal WT + MO1-ptch1 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 3Fig. 4 with image from Ochi et al., 2006
whole organism ptch2 expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
somite muscle pioneer increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 5 with image from Ochi et al., 2006
fast muscle cell decreased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 3 from Ochi et al., 2006
slow muscle cell increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 3Fig. 4 with image from Ochi et al., 2006
whole organism hhip expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
somite slow muscle cell increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 5 with image from Ochi et al., 2006
whole organism foxa expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
somite U-shaped, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 4 with image from Ochi et al., 2006
whole organism gli1 expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
whole organism nkx2.2b expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
fast muscle cell mislocalised, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer mislocalised, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
adaxial cell dispersed, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer increased amount, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell absent, abnormal smob641/b641 + MO1-ptch1 + MO1-ptch2(AB) standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 + MO2-hhip + MO3-hhip standard conditions Fig. 3 from Ochi et al., 2006
muscle pioneer increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 + MO2-hhip + MO3-hhip standard conditions Fig. 3 from Ochi et al., 2006
fast muscle cell decreased amount, abnormal ndr2tf219/tf219; shhaDf(Chr07)t4/t4 + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer absent, abnormal ndr2tf219/tf219; shhaDf(Chr07)t4/t4 + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
Genome Resources:
CITATIONS (9)