header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050308-2
Morpholino Name: MO2-ptch2
Target: ptch2 (1)
Previous Names: MO2-ptc1, ptc1 MO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGCTGAAGAAAGTTAAAGGCAAACG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a translation blocking morpholino.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ptch2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ptch2 No data available
PHENOTYPE
Phenotype resulting from MO2-ptch2
No data available

Phenotype of all Fish created by or utilizing MO2-ptch2
No data available
OTHER MO2-ptch2 MORPHOLINO PAGES No links to external sites
CITATIONS (1)