ZFIN ID: ZDB-MRPHLNO-050301-2
Morpholino Name: MO4-neurog1
Target: neurog1 (1)
Previous Name: ngn1 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TATACGATCTCCATTGTTGATAACC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-neurog1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-neurog1
Expressed Gene Anatomy Figures
ascl1a Fig. 4 with image from Scholpp et al., 2009
atoh1b Fig. 2 with image from Hans et al., 2013
cdh6 Fig. 2 with image from Hans et al., 2013
hmx3a Fig. 2 with image from Hans et al., 2013
irx1b Fig. 4 with image from Scholpp et al., 2009
isl1 Fig. 5 with image from Dyer et al., 2014
myo7aa Fig. 2 with image from Hans et al., 2013
neurod1 Fig. 2 with image from Hans et al., 2013
Fig. S6 from Yoshizawa et al., 2011
slc17a6b Fig. 4 with image from Scholpp et al., 2009
stm Fig. 2 with image from Hans et al., 2013
tbx1 Fig. 2 with image from Hans et al., 2013
PHENOTYPE
Phenotype resulting from MO4-neurog1
Phenotype Figures
neuromast mislocalised, abnormal Fig. 8 from Hernandez et al., 2007
otic vesicle neuroblast (sensu Vertebrata) physical object quality, abnormal Fig. 2 with image from Hans et al., 2013
otic vesicle neuroblast (sensu Vertebrata) poorly differentiated, abnormal Fig. 2 with image from Hans et al., 2013
otic vesicle neuron differentiation decreased process quality, abnormal Fig. 2 with image from Hans et al., 2013
posterior lateral line ganglion absent, abnormal Fig. 3 from Sarrazin et al., 2010
Rohon-Beard neuron decreased amount, abnormal Fig. 5 with image from Dyer et al., 2014

Phenotype of all Fish created by or utilizing MO4-neurog1
Phenotype Fish Conditions Figures
otic vesicle neuron differentiation decreased process quality, abnormal AB + MO4-neurog1 standard conditions Fig. 2 with image from Hans et al., 2013
otic vesicle neuroblast (sensu Vertebrata) physical object quality, abnormal AB + MO4-neurog1 standard conditions Fig. 2 with image from Hans et al., 2013
otic vesicle neuroblast (sensu Vertebrata) poorly differentiated, abnormal AB + MO4-neurog1 standard conditions Fig. 2 with image from Hans et al., 2013
Rohon-Beard neuron decreased amount, abnormal WT + MO4-neurog1 standard conditions Fig. 5 with image from Dyer et al., 2014
neuromast mislocalised, abnormal sqet20Et + MO4-neurog1 standard conditions Fig. 8 from Hernandez et al., 2007
posterior lateral line ganglion absent, abnormal zf106Tg + MO4-neurog1 standard conditions Fig. 3 from Sarrazin et al., 2010
otic vesicle neurogenesis decreased process quality, abnormal Df(Chr12:dlx3b,dlx4b,tbx6)b380/b380 + MO4-neurog1 standard conditions Fig. 4 with image from Hans et al., 2013
otic vesicle morphogenesis decreased process quality, abnormal Df(Chr12:dlx3b,dlx4b,tbx6)b380/b380 + MO4-neurog1 standard conditions Fig. 4 with image from Hans et al., 2013
otic vesicle malformed, abnormal Df(Chr12:dlx3b,dlx4b,tbx6)b380/b380 + MO4-neurog1 standard conditions Fig. 4 with image from Hans et al., 2013
OTHER MO4-neurog1 MORPHOLINO PAGESNo links to external sites
CITATIONS (12)