ZFIN ID: ZDB-MRPHLNO-050209-1
Morpholino Name: MO1-foxi1
Target: foxi1
Sequence:
5' - TAATCCGCTCTCCCTCCAGAAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: foxi1-MO translation blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-foxi1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-foxi1
Expressed Gene Anatomy Figures
atoh1b Fig. 7 with image from Millimaki et al., 2007
dlx3b Fig. 8 with image from Mackereth et al., 2005
hand2 Fig. 5 with image from Wendl et al., 2007
nkx2.4b Fig. 5 with image from Wendl et al., 2007
pax2a Fig. 8 with image from Mackereth et al., 2005
PHENOTYPE
Phenotype resulting from MO1-foxi1
Phenotype Figures
otic vesicle decreased size, abnormal Fig. 8 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal Fig. 8 with image from Mackereth et al., 2005

Phenotype of all Fish created by or utilizing MO1-foxi1
Phenotype Fish Conditions Figures
otic vesicle morphogenesis process quality, abnormal WT + MO1-foxi1 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle decreased size, abnormal WT + MO1-foxi1 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle decreased size, abnormal WT + MO1-foxi1 + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal WT + MO1-foxi1 + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
OTHER MO1-foxi1 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)