ZFIN ID: ZDB-MRPHLNO-050208-11
Morpholino Name: MO2-gata1a
Target: gata1a (1)
Previous Names: MO(S)-gata1 (1), MO2-gata1, gata1 splice MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTTTGGACTCACCTGGACTGTGTCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: A splice blocking morpholino targeting the first exon/intron boundary of gata1.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-gata1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-gata1a
Expressed Gene Anatomy Figures
hamp Fig. 7 from Fraenkel et al., 2009
PHENOTYPE
Phenotype resulting from MO2-gata1a
No data available

Phenotype of all Fish created by or utilizing MO2-gata1a
No data available
Genome Resources:
CITATIONS (9)