header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050207-2
Morpholino Name: MO2-tal1
Target: tal1 (1)
Previous Names: SCL E2/I, tal1 MO E2/I

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AATGCTCTTACCATCGTTGATTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Originally reported to target the exon/intron boundary of exon 2. Current analysis suggests this boundary to be exon/intron 3. This morpholino is one bp shorter than MO4-tal1, which is reported to hybridize to exon/intron 3.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-tal1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-tal1 No data available
PHENOTYPE
Phenotype resulting from MO2-tal1
No data available

Phenotype of all Fish created by or utilizing MO2-tal1
No data available
OTHER MO2-tal1 MORPHOLINO PAGES No links to external sites
CITATIONS (6)