ZFIN ID: ZDB-MRPHLNO-050201-3
Morpholino Name: MO1-nkx6.1
Target: nkx6.1
Previous Name: nkx6.1-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGCAAGAAGAAGGACAGTGACCCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Blocks translation.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-nkx6.1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-nkx6.1
Expressed Gene Anatomy Figures
alcama Fig. 8 with image from Cheesman et al., 2004
isl1 Fig. 2 with image from Hutchinson et al., 2007
Fig. 8 with image from Cheesman et al., 2004
isl2a Fig. 2 with image from Hutchinson et al., 2007
PHENOTYPE
Phenotype resulting from MO1-nkx6.1
Phenotype of all Fish created by or utilizing MO1-nkx6.1
Phenotype Fish Conditions Figures
primary motor neuron axon decreased amount, abnormal AB + MO1-nkx6.1 standard conditions Fig. 3 with image from Hutchinson et al., 2007
primary motor neuron axon branched, abnormal AB + MO1-nkx6.1 standard conditions Fig. 3 with image from Hutchinson et al., 2007
neuron fate commitment disrupted, abnormal AB + MO1-nkx6.1 standard conditions Fig. 8 with image from Cheesman et al., 2004
primary motor neuron axon decreased length, abnormal AB + MO1-nkx6.1 standard conditions Fig. 3 with image from Hutchinson et al., 2007
VeLD increased amount, abnormal AB + MO1-nkx6.1 standard conditions Fig. 8 with image from Cheesman et al., 2004
secondary motor neuron decreased amount, abnormal AB + MO1-nkx6.1 standard conditions Fig. 8 with image from Cheesman et al., 2004
pancreatic bud has fewer parts of type pancreatic A cell, abnormal AB + MO1-nkx6.1 + MO2-nkx6.1 standard conditions Fig. 4 with image from Binot et al., 2010
pancreas primordium has fewer parts of type endocrine cell, abnormal AB + MO1-nkx6.1 + MO2-nkx6.1 standard conditions Fig. 7 with imageFig. 8 with image from Binot et al., 2010
pancreatic bud has fewer parts of type endocrine cell, abnormal AB + MO1-nkx6.1 + MO2-nkx6.1 standard conditions Fig. 7 with image from Binot et al., 2010
primary motor neuron axon decreased length, abnormal AB + MO1-nkx6.1 + MO1-nkx6.2 standard conditions Fig. 3 with imageFig. 4 with image from Hutchinson et al., 2007
primary motor neuron axon decreased amount, abnormal AB + MO1-nkx6.1 + MO1-nkx6.2 standard conditions Fig. 3 with image from Hutchinson et al., 2007
primary motor neuron axon branched, abnormal AB + MO1-nkx6.1 + MO1-nkx6.2 standard conditions Fig. 3 with imageFig. 4 with image from Hutchinson et al., 2007
primary motor neuron axon structure, abnormal AB + MO1-nkx6.1 + MO1-nkx6.2 standard conditions Fig. 4 with image from Hutchinson et al., 2007
Genome Resources:
CITATIONS (5)