header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050119-6
Morpholino Name: MO1-lft1
Target: lft1 (1)
Previous Name: lft1 atv MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAAGTCATCTTTTCAAGGTGCAGGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lft1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lft1
Expressed Gene Anatomy Figures
lft1 Fig. 1 with image from Lenhart et al., 2011
pitx2 Fig. 6 from Burdine et al., 2016
shha Fig. 1 from Zhang et al., 2004
spaw Fig. 1 with image from Lenhart et al., 2011
tbxta Fig. S4 from Zhang et al., 2004
PHENOTYPE
Phenotype resulting from MO1-lft1
No data available

Phenotype of all Fish created by or utilizing MO1-lft1
No data available
OTHER MO1-lft1 MORPHOLINO PAGES No links to external sites
CITATIONS (7)