header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-041129-2
Morpholino Name: MO2-shhb
Target: shhb (1)
Previous Names: MO2-twhh (1), twhh MO (1), twhh-MO (2), twhh-MO-2

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCCATGACGTTTGAATTATCTCTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: A translation blocking morpholino targeting twhh. These embryos have a normal head, v-shaped somites, and a normal myoseptum.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-shhb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-shhb
Expressed Gene Anatomy Figures
alcama Fig. 5 with image from Park et al., 2004
olig2 Fig. 5 with image from Park et al., 2004
sox10 Fig. 5 with image from Park et al., 2004
PHENOTYPE
Phenotype resulting from MO2-shhb
Phenotype of all Fish created by or utilizing MO2-shhb
OTHER MO2-shhb MORPHOLINO PAGES
  • MODB:18 (2)
  • CITATIONS (14)