CRISPR

CRISPR1-gfi1ab

ID

ZDB-CRISPR-231006-17

Name

CRISPR1-gfi1ab

Previous Names

None

Target

gfi1ab (1)

Sequence

5' - GGTACTCGGGGTGTGAAATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
szy10	gfi1ab

Expression

Gene expression in Wild Types + CRISPR1-gfi1ab

No data available

Phenotype

Phenotype resulting from CRISPR1-gfi1ab

No data available

Phenotype of all Fish created by or utilizing CRISPR1-gfi1ab

Phenotype	Fish	Conditions	Figures
erythroid lineage cell sptb expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10	standard conditions	FIGURE 1 from Wu et al., 2022
endothelial cell clec14a expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10	standard conditions	FIGURE 2 from Wu et al., 2022
endothelial cell cdh5 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10	standard conditions	FIGURE 2 from Wu et al., 2022
erythroid lineage cell epb41b expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10	standard conditions	FIGURE 1 from Wu et al., 2022
endothelial cell sox7 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10	standard conditions	FIGURE 2 from Wu et al., 2022
erythroid lineage cell hbae3 expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10	standard conditions	FIGURE 1 from Wu et al., 2022
erythroid lineage cell hbbe3 expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10	standard conditions	FIGURE 1 from Wu et al., 2022
erythroid lineage cell tfr1a expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10	standard conditions	FIGURE 1 from Wu et al., 2022
endothelial cell flt4 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10	standard conditions	FIGURE 2 from Wu et al., 2022
endothelial cell egfl7 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10	standard conditions	FIGURE 2 from Wu et al., 2022
erythroid lineage cell alas2 expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10	standard conditions	FIGURE 1 from Wu et al., 2022
erythroid lineage cell tfr1a expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
erythroid lineage cell alas2 expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
erythroid lineage cell hbbe3 expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
erythroid lineage cell epb41b expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
erythroid lineage cell hbae3 expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
endothelial cell flt4 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022
erythroid lineage cell sptb expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
endothelial cell clec14a expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022
endothelial cell cdh5 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022
endothelial cell egfl7 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022
endothelial cell sox7 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022

Citations