CRISPR

CRISPR2-pdx1

ID

ZDB-CRISPR-211027-14

Name

CRISPR2-pdx1

Previous Names

None

Target

pdx1 (1)

Sequence

5' - GGAGACTCTCTGGACCTCTGCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uh10	pdx1

Expression

Gene expression in Wild Types + CRISPR2-pdx1

No data available

Phenotype

Phenotype resulting from CRISPR2-pdx1

No data available

Phenotype of all Fish created by or utilizing CRISPR2-pdx1

Phenotype	Fish	Conditions	Figures
whole organism ornithine decreased amount, abnormal	pdx1^uh10/uh10	standard conditions	Fig. 8 from Wiggenhauser et al., 2020
whole organism proline increased amount, abnormal	pdx1^uh10/uh10	standard conditions	Fig. 8 from Wiggenhauser et al., 2020
whole organism glutamic acid increased amount, abnormal	pdx1^uh10/uh10	standard conditions	Fig. 8 from Wiggenhauser et al., 2020
whole organism pdx1 expression absent, abnormal	pdx1^uh10/uh10	standard conditions	Fig. 1 from Wiggenhauser et al., 2020
whole organism glucose increased amount, abnormal	pdx1^uh10/uh10	standard conditions	Fig. 8 from Wiggenhauser et al., 2020
whole organism taurine increased amount, abnormal	pdx1^uh10/uh10	standard conditions	Fig. 8 from Wiggenhauser et al., 2020
whole organism spermidine decreased amount, abnormal	pdx1^uh10/uh10	standard conditions	Fig. 8 from Wiggenhauser et al., 2020
whole organism tyrosine decreased amount, abnormal	pdx1^uh10/uh10	standard conditions	Fig. 8 from Wiggenhauser et al., 2020
kidney phosphoethanolamine increased amount, abnormal	pdx1^uh10/+; li1Tg	standard conditions	Fig. 4 from Wiggenhauser et al., 2022
renal glomerulus hypertrophic, abnormal	pdx1^uh10/+; li1Tg	standard conditions	Fig. 2 from Wiggenhauser et al., 2022
renal glomerulus cell increased amount, abnormal	pdx1^uh10/+; li1Tg	standard conditions	Fig. 2 from Wiggenhauser et al., 2022
pronephric glomerulus increased length, abnormal	pdx1^uh10/+; li1Tg	standard conditions	Fig. 1 from Wiggenhauser et al., 2022
pronephric tubule decreased length, abnormal	pdx1^uh10/+; li1Tg	standard conditions	Fig. 1 from Wiggenhauser et al., 2022
kidney hexose decreased amount, abnormal	pdx1^uh10/+; li1Tg	standard conditions	Fig. 4 from Wiggenhauser et al., 2022
renal glomerulus increased area, abnormal	pdx1^uh10/+; li1Tg	standard conditions	Fig. 2 from Wiggenhauser et al., 2022
primary islet decreased area, abnormal	pdx1^uh10/+; ml2Tg	standard conditions	Fig. 2 from Wiggenhauser et al., 2020
endocrine pancreas development decreased process quality, abnormal	pdx1^uh10/+; ml2Tg	standard conditions	Fig. 2 from Wiggenhauser et al., 2020
ocular blood vessel sprouting angiogenesis increased process quality, abnormal	pdx1^uh10/+; y1Tg	standard conditions	Fig. 5 from Wiggenhauser et al., 2020
ocular blood vessel increased branchiness, abnormal	pdx1^uh10/+; y1Tg	standard conditions	Fig. 5 from Wiggenhauser et al., 2020
glucose homeostasis decreased process quality, abnormal	pdx1^uh10/+; y1Tg	standard conditions	Fig. 5 from Wiggenhauser et al., 2020
pronephros decreased functionality, abnormal	pdx1^uh10/uh10; li1Tg	control	Fig. 1 from Wiggenhauser et al., 2022
pronephric glomerulus increased length, abnormal	pdx1^uh10/uh10; li1Tg	standard conditions	Fig. 1 from Wiggenhauser et al., 2022
pronephric tubule decreased length, abnormal	pdx1^uh10/uh10; li1Tg	standard conditions	Fig. 1 from Wiggenhauser et al., 2022
glomerular basement membrane increased thickness, abnormal	pdx1^uh10/uh10; li1Tg	standard conditions	Fig. 2 from Wiggenhauser et al., 2022
primary islet decreased area, abnormal	pdx1^uh10/uh10; ml2Tg	standard conditions	Fig. 2 from Wiggenhauser et al., 2020
whole organism glucose increased amount, abnormal	pdx1^uh10/uh10; ml2Tg	standard conditions	Fig. 2 from Wiggenhauser et al., 2020
glucose homeostasis decreased process quality, abnormal	pdx1^uh10/uh10; ml2Tg	standard conditions	Fig. 2 from Wiggenhauser et al., 2020
endocrine pancreas development decreased process quality, abnormal	pdx1^uh10/uh10; ml2Tg	standard conditions	Fig. 2 from Wiggenhauser et al., 2020
inner optic circle diameter, ameliorated	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: N(gamma)-nitro-L-arginine methyl ester hydrochloride	Fig. 7 from Wiggenhauser et al., 2020
ocular blood vessel increased branchiness, abnormal	pdx1^uh10/uh10; y1Tg	standard conditions	Fig. 4 from Wiggenhauser et al., 2020
hyaloid vessel diameter, ameliorated	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: PK-11195	Fig. 7 from Wiggenhauser et al., 2020
inner optic circle diameter, ameliorated	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: PK-11195	Fig. 7 from Wiggenhauser et al., 2020
hyaloid vessel branchiness, ameliorated	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: vatalanib	Fig. 6 from Wiggenhauser et al., 2020
hyaloid vessel sprouting angiogenesis process quality, ameliorated	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: vatalanib	Fig. 6 from Wiggenhauser et al., 2020
hyaloid vessel increased branchiness, abnormal	pdx1^uh10/uh10; y1Tg	standard conditions	Fig. 3, Fig. 6 from Wiggenhauser et al., 2020
hyaloid vessel sprouting angiogenesis increased process quality, abnormal	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: metformin	Fig. 6 from Wiggenhauser et al., 2020
inner optic circle diameter, ameliorated	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: metformin	Fig. 7 from Wiggenhauser et al., 2020
hyaloid vessel sprouting angiogenesis increased process quality, abnormal	pdx1^uh10/uh10; y1Tg	standard conditions	Fig. 3, Fig. 6 from Wiggenhauser et al., 2020
hyaloid vessel diameter, ameliorated	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: metformin	Fig. 7 from Wiggenhauser et al., 2020
ocular blood vessel sprouting angiogenesis increased process quality, abnormal	pdx1^uh10/uh10; y1Tg	standard conditions	Fig. 4 from Wiggenhauser et al., 2020
hyaloid vessel diameter, ameliorated	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: N(gamma)-nitro-L-arginine methyl ester hydrochloride	Fig. 7 from Wiggenhauser et al., 2020
inner optic circle increased diameter, abnormal	pdx1^uh10/uh10; y1Tg	standard conditions	Fig. 3, Fig. 7 from Wiggenhauser et al., 2020
hyaloid vessel sprouting angiogenesis increased process quality, abnormal	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: N(gamma)-nitro-L-arginine methyl ester hydrochloride	Fig. 6 from Wiggenhauser et al., 2020
hyaloid vessel increased diameter, abnormal	pdx1^uh10/uh10; y1Tg	standard conditions	Fig. 3, Fig. 7 from Wiggenhauser et al., 2020
hyaloid vessel sprouting angiogenesis process quality, ameliorated	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: PK-11195	Fig. 6 from Wiggenhauser et al., 2020
hyaloid vessel branchiness, ameliorated	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: PK-11195	Fig. 6 from Wiggenhauser et al., 2020
inner optic circle diameter, ameliorated	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: vatalanib	Fig. 7 from Wiggenhauser et al., 2020
hyaloid vessel branchiness, ameliorated	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: metformin	Fig. 6 from Wiggenhauser et al., 2020
hyaloid vessel increased branchiness, abnormal	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: N(gamma)-nitro-L-arginine methyl ester hydrochloride	Fig. 6 from Wiggenhauser et al., 2020
glucose homeostasis decreased process quality, abnormal	pdx1^uh10/uh10; y1Tg	standard conditions	Fig. 4 from Wiggenhauser et al., 2020
hyaloid vessel diameter, ameliorated	pdx1^uh10/uh10; y1Tg	chemical treatment by environment: vatalanib	Fig. 7 from Wiggenhauser et al., 2020

Citations