CRISPR

CRISPR2-pdx1

ID
ZDB-CRISPR-211027-14
Name
CRISPR2-pdx1
Previous Names
None
Target
Sequence
5' - GGAGACTCTCTGGACCTCTGCGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uh10 pdx1
Expression
Gene expression in Wild Types + CRISPR2-pdx1
No data available
Phenotype
Phenotype resulting from CRISPR2-pdx1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-pdx1
Citations