CRISPR

CRISPR2-pnpo

ID
ZDB-CRISPR-200630-4
Name
CRISPR2-pnpo
Previous Names
None
Target
Sequence
5' - GGCTAAAAGGCTACAGCGAGGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Two additional "G"s were added at the 5' end and the PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3301 pnpo
Expression
Gene expression in Wild Types + CRISPR2-pnpo
No data available
Phenotype
Phenotype resulting from CRISPR2-pnpo
No data available
Phenotype of all Fish created by or utilizing CRISPR2-pnpo
Phenotype Fish Conditions Figures
whole organism swimming behavior increased process quality, abnormal pnpozf3301/zf3301 (TL) standard conditions Fig. 3 from Ciapaite et al., 2019
whole organism glutamate(1-) decreased amount, abnormal pnpozf3301/zf3301 (TL) control Fig. 5 from Ciapaite et al., 2019
whole organism 4-pyridoxic acid amount, ameliorated pnpozf3301/zf3301 (TL) chemical treatment by environment: pyridoxal 5'-phosphate Fig. 4 from Ciapaite et al., 2019
whole organism 4-pyridoxic acid decreased amount, abnormal pnpozf3301/zf3301 (TL) control Fig. 4 from Ciapaite et al., 2019
whole organism pyridoxamine 5'-phosphate increased amount, abnormal pnpozf3301/zf3301 (TL) control Fig. 4 from Ciapaite et al., 2019
whole organism pyridoxal decreased amount, abnormal pnpozf3301/zf3301 (TL) control Fig. 4 from Ciapaite et al., 2019
whole organism pyridoxine 5'-phosphate amount, ameliorated pnpozf3301/zf3301 (TL) chemical treatment by environment: pyridoxal 5'-phosphate Fig. 4 from Ciapaite et al., 2019
whole organism pyridoxine 5'-phosphate increased amount, abnormal pnpozf3301/zf3301 (TL) control Fig. 4 from Ciapaite et al., 2019
whole organism glycine decreased amount, abnormal pnpozf3301/zf3301 (TL) control Fig. 5 from Ciapaite et al., 2019
whole organism pyridoxamine increased amount, abnormal pnpozf3301/zf3301 (TL) chemical treatment by environment: pyridoxal 5'-phosphate Fig. 4 from Ciapaite et al., 2019
whole organism pyridoxamine 5'-phosphate increased amount, abnormal pnpozf3301/zf3301 (TL) chemical treatment by environment: pyridoxal 5'-phosphate Fig. 4 from Ciapaite et al., 2019
whole organism glycine amount, ameliorated pnpozf3301/zf3301 (TL) chemical treatment by environment: pyridoxal 5'-phosphate Fig. 5 from Ciapaite et al., 2019
whole organism pyridoxamine increased amount, abnormal pnpozf3301/zf3301 (TL) control Fig. 4 from Ciapaite et al., 2019
whole organism gamma-aminobutyric acid amount, ameliorated pnpozf3301/zf3301 (TL) chemical treatment by environment: pyridoxal 5'-phosphate Fig. 5 from Ciapaite et al., 2019
whole organism viability, ameliorated pnpozf3301/zf3301 (TL) chemical treatment by environment: pyridoxal 5'-phosphate Fig. 4 from Ciapaite et al., 2019
whole organism pyridoxamine phosphate oxidase activity decreased process quality, abnormal pnpozf3301/zf3301 (TL) standard conditions Fig. 2 from Ciapaite et al., 2019
whole organism glutamate(1-) amount, ameliorated pnpozf3301/zf3301 (TL) chemical treatment by environment: pyridoxal 5'-phosphate Fig. 5 from Ciapaite et al., 2019
whole organism pyridoxal 5'-phosphate decreased amount, abnormal pnpozf3301/zf3301 (TL) control Fig. 4 from Ciapaite et al., 2019
whole organism dead, abnormal pnpozf3301/zf3301 (TL) standard conditions Fig. 3 from Ciapaite et al., 2019
whole organism gamma-aminobutyric acid decreased amount, abnormal pnpozf3301/zf3301 (TL) control Fig. 5 from Ciapaite et al., 2019
whole organism pyridoxal amount, ameliorated pnpozf3301/zf3301 (TL) chemical treatment by environment: pyridoxal 5'-phosphate Fig. 4 from Ciapaite et al., 2019
whole organism pyridoxal 5'-phosphate amount, ameliorated pnpozf3301/zf3301 (TL) chemical treatment by environment: pyridoxal 5'-phosphate Fig. 4 from Ciapaite et al., 2019
whole organism viability, abnormal pnpozf3301/zf3301 (TL) control Fig. 3,  Fig. 4 from Ciapaite et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.