header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-191009-58
CRISPR Name: CRISPR7-smc3
Target: smc3 (1)
Source:
Target Sequence:
5' - TACCTGTTTAATGTACATGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR7-smc3 No data available
GENOMIC FEATURES CREATED WITH CRISPR7-smc3 No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR7-smc3 No data available
PHENOTYPE
Phenotype resulting from CRISPR7-smc3
No data available

Phenotype of all Fish created by or utilizing CRISPR7-smc3
No data available
Genome Resources:
CITATIONS (1)