ZFIN ID: ZDB-CRISPR-190917-2
CRISPR Name: CRISPR1-smyd1b
Target: smyd1b (1)
Source:
Target Sequence:
5' - GAATCAGCTGACGACTCTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The "G" at the beginning was likely added to improve binding.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-smyd1b No data available
GENOMIC FEATURES CREATED WITH CRISPR1-smyd1b No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-smyd1b No data available
PHENOTYPE
Phenotype resulting from CRISPR1-smyd1b
No data available

Phenotype of all Fish created by or utilizing CRISPR1-smyd1b
Genome Resources:
CITATIONS (1)