CRISPR

CRISPR1-sost

ID
ZDB-CRISPR-190909-3
Name
CRISPR1-sost
Previous Names
None
Target
Sequence
5' - GGGAGTGAGCAGGGATGCAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
w215Tg sost
w216Tg sost
Expression
Gene expression in Wild Types + CRISPR1-sost
No data available
Phenotype
Phenotype resulting from CRISPR1-sost
No data available
Phenotype of all Fish created by or utilizing CRISPR1-sost
Phenotype Fish Conditions Figures
neuromast hair cell amount, abnormal sostw216Tg chemical ablation: neuromast support cell, chemical treatment by environment: LY-411575, chemical treatment by environment: neomycin, chemical ablation: neuromast hair cell Fig. 7 with image from Thomas et al., 2019
neuromast hair cell increased amount, abnormal sostw216Tg chemical treatment by environment: neomycin, chemical treatment by environment: LY-411575, chemical ablation: neuromast hair cell Fig. 7 with image from Thomas et al., 2019
neuromast hair cell decreased amount, abnormal sostw216Tg chemical ablation: neuromast support cell, chemical treatment by environment: neomycin, chemical ablation: neuromast hair cell Fig. 7 with image from Thomas et al., 2019
neuromast GFP expression increased distribution, abnormal sostw216Tg chemical ablation: neuromast support cell, chemical treatment by environment: neomycin Fig. 10 with image from Thomas et al., 2019
neuromast hair cell increased amount, abnormal s356tTg ; sostw215Tg chemical treatment by environment: neomycin, chemical treatment by environment: LY-411575, chemical ablation: neuromast hair cell Fig. 4 with image from Thomas et al., 2019
neuromast support cell cell population proliferation increased occurrence, abnormal s356tTg ; sostw215Tg chemical treatment by environment: neomycin, chemical ablation: neuromast hair cell Fig. 3 with image from Thomas et al., 2019
neuromast hair cell cell population proliferation increased occurrence, abnormal s356tTg ; sostw215Tg chemical treatment by environment: neomycin, chemical ablation: neuromast hair cell Fig. 3 with image from Thomas et al., 2019
neuromast hair cell cell population proliferation increased occurrence, abnormal s356tTg ; sostw215Tg chemical treatment by environment: neomycin, chemical treatment by environment: LY-411575, chemical ablation: neuromast hair cell Fig. 4 with image from Thomas et al., 2019
neuromast Eos expression increased distribution, abnormal sostw215Tg ; sostw216Tg chemical ablation: neuromast support cell, chemical treatment by environment: neomycin Fig. 5 with image from Thomas et al., 2019
neuromast Eos expression decreased distribution, abnormal sostw215Tg ; sostw216Tg chemical ablation: neuromast support cell, chemical treatment by environment: neomycin, chemical ablation: neuromast hair cell Fig. 6 with image from Thomas et al., 2019
neuromast hair cell decreased amount, abnormal sostw215Tg ; sostw216Tg chemical ablation: neuromast support cell, chemical treatment by environment: neomycin, chemical ablation: neuromast hair cell Fig. 6 with image from Thomas et al., 2019
neuromast hair cell decreased amount, abnormal sostw216Tg ; tnfsf10l3w218Tg chemical ablation: neuromast support cell, chemical treatment by environment: neomycin, chemical ablation: neuromast hair cell Fig. 9 with image from Thomas et al., 2019
neuromast Eos expression increased distribution, abnormal sostw216Tg ; tnfsf10l3w218Tg chemical ablation: neuromast support cell, chemical treatment by environment: neomycin, chemical ablation: neuromast hair cell Fig. 9 with image from Thomas et al., 2019
Citations