CRISPR

CRISPR1-asip1

ID

ZDB-CRISPR-190725-1

Name

CRISPR1-asip1

Previous Names

None

Target

asip1 (1)

Sequence

5' - GCACACACACATGCCAATGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
iim016	asip1
iim02	asip1
iim08	asip1

Expression

Gene expression in Wild Types + CRISPR1-asip1

No data available

Phenotype

Phenotype resulting from CRISPR1-asip1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-asip1

Phenotype	Fish	Conditions	Figures
head ventral surface has extra parts of type melanocyte, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 , Fig. 3 , Fig. 4 , Fig. 7 from Cal et al., 2019
trunk ventral surface has extra parts of type xanthophore, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 , Fig. 4 , Fig. 7 from Cal et al., 2019
melanocyte increased amount, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 from Cal et al., 2019
xanthophore increased amount, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 from Cal et al., 2019
scale ventral region has extra parts of type iridophore, abnormal	asip1^iim08/iim08	standard conditions	Fig. 6 from Cal et al., 2019
trunk ventral surface has extra parts of type melanocyte, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 , Fig. 3 , Fig. 4 , Fig. 7 from Cal et al., 2019
ventral mandibular arch has extra parts of type melanocyte, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 from Cal et al., 2019
scale ventral region has extra parts of type xanthophore, abnormal	asip1^iim08/iim08	standard conditions	Fig. 6 from Cal et al., 2019
melanophore stripe has extra parts of type melanocyte, abnormal	asip1^iim08/iim08	standard conditions	Fig. 4 , Fig. 7 from Cal et al., 2019
trunk ventral surface has fewer parts of type iridophore, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 , Fig. 7 from Cal et al., 2019
melanophore stripe dorsalized, abnormal	asip1^iim08/iim08	standard conditions	Fig. 2 from Cal et al., 2019
scale ventral region has extra parts of type melanocyte, abnormal	asip1^iim08/iim08	standard conditions	Fig. 6 from Cal et al., 2019
scale ventral region dorsalized, abnormal	asip1^iim08/iim08	standard conditions	Fig. 6 from Cal et al., 2019
iridophore irregular spatial pattern, abnormal	asip1^iim08/iim08; tdl358Et	standard conditions	Fig. 5 from Cal et al., 2019
trunk ventral surface has fewer parts of type iridophore, abnormal	asip1^iim08/iim08; tdl358Et	standard conditions	Fig. 5 from Cal et al., 2019
trunk ventral surface has extra parts of type xanthophore, abnormal	asip1^iim08/iim08; tdl358Et	standard conditions	Fig. 5 from Cal et al., 2019
trunk ventral surface has extra parts of type melanocyte, abnormal	asip1^iim08/iim08; tdl358Et	standard conditions	Fig. 5 from Cal et al., 2019
trunk dorsal surface has fewer parts of type melanocyte, abnormal	asip1^iim08; iim05Tg	standard conditions	Fig. 7 from Cal et al., 2019

Citations