CRISPR

CRISPR1-tonsl

ID
ZDB-CRISPR-190724-4
Name
CRISPR1-tonsl
Previous Names
None
Target
Sequence
5' - GGAGAGTGCTATGCAGAGCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
b1347 tonsl
b1348 tonsl
Expression
Gene expression in Wild Types + CRISPR1-tonsl
No data available
Phenotype
Phenotype resulting from CRISPR1-tonsl
No data available
Phenotype of all Fish created by or utilizing CRISPR1-tonsl
Phenotype Fish Conditions Figures
feeding behavior decreased occurrence, abnormal tonslb1347/b1347 standard conditions Fig. 2 from Burrage et al., 2019
centrum increased amount, abnormal tonslb1347/b1347 standard conditions Fig. 2 from Burrage et al., 2019
whole organism decreased life span, abnormal tonslb1347/b1347 standard conditions Fig. 2 from Burrage et al., 2019
whole organism decreased size, abnormal tonslb1347/b1347 standard conditions Fig. 2 from Burrage et al., 2019
ossification increased occurrence, abnormal tonslb1347/b1347 standard conditions Fig. 2 from Burrage et al., 2019
whole organism decreased length, abnormal tonslb1347/b1347 standard conditions Fig. 2 from Burrage et al., 2019
whole organism decreased life span, abnormal tonslb1348/b1348 standard conditions Fig. 2 from Burrage et al., 2019
feeding behavior decreased occurrence, abnormal tonslb1348/b1348 standard conditions Fig. 2 from Burrage et al., 2019
centrum increased amount, abnormal tonslb1348/b1348 standard conditions Fig. 2 from Burrage et al., 2019
whole organism decreased size, abnormal tonslb1348/b1348 standard conditions Fig. 2 from Burrage et al., 2019
ossification increased occurrence, abnormal tonslb1348/b1348 standard conditions Fig. 2 from Burrage et al., 2019
whole organism decreased length, abnormal tonslb1348/b1348 standard conditions Fig. 2 from Burrage et al., 2019
gut neutrophil GFP expression decreased amount, abnormal i114Tg ; tonslb1347/b1347 standard conditions Fig. 2 from Burrage et al., 2019
gut neutrophil decreased amount, abnormal i114Tg ; tonslb1347/b1347 standard conditions Fig. 2 from Burrage et al., 2019
gut neutrophil GFP expression decreased amount, abnormal i114Tg ; tonslb1348/b1348 standard conditions Fig. 2 from Burrage et al., 2019
gut neutrophil decreased amount, abnormal i114Tg ; tonslb1348/b1348 standard conditions Fig. 2 from Burrage et al., 2019
Citations