Genomic Feature

b1348

ID
ZDB-ALT-190724-7
Name
b1348
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Westerfield Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 17: 8801307 - 8801319 (GRCz11) (1) Details
Nucleotide change
GAGCTGGGAAACA/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
13 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AATTAAAATTTCCTCATCATTTAGTCACTTAAATGTTTCCAGACTTGTATGATTTGTTGTCTTCTGTTGAAAACAAAATAAGATTCTGAAGAATGTTGGGGAAAAATTAGCCATCGGCATGCATAAAATACTACTGCTGTTTTTTTCCCCAACATTATTCAGTATATTTTTCTTTATGATCAACAGAAGAAGCTCAAATGGTTTTAAAACAAGTGGAGGATGAGTGAATGATGACTGAATCTTCACTTTTGGTTAAACAATCCCTTCAATAACAATAATCTGGGCTCTTAACCCAAACCCTAAAAGAGTTGCTCTGTGAACGATCTTCTTGATAATTATCTGCATTATTATGTATGAATGTATAGATAATCAGACTTGTTTCCCTAGGTGACTATCAAGCTGCTATTGAAGAGCATCGACAGGAATTAGCGCTGTCTGAGATTTTGCACGATGTGATTGGATCTGCTGTGGCCAATAGAAAGATTGGAGAGTGCTATGCA
GAGCTGGGAAACA/- TCGAAGCTGCACTGAAGGTTTGGAAACCTACATTTGCATTTATGCATTTGGCAGACAGTTCATCAGTTCTTGCTTTCTCAGGGAATTGAACAGAACTTTGGCATTTCTAGCAACTACTATTTAAGCTACAGTAAACGCATGCATGTATTCGTCTTAGTGGCGGAAAAATGACTGATCTAAAAATGTAGTGCGAGAAAGTATTTGTTTGTAAAATATGAGTTAAGTAGTACTCAAGAGTAGTTAGTATTACGCTGTGAAATTAGTTGACTGTATACTGTATAAGTAGGGCTCGTACGGGTGCTGGCAATGCTGGAAAATGCTAAATATTTAATATAGTGGTGTCAAGATAAGAAAAGTGCTTGGATTTTAGACAAAGTGCTTGTACCTACTTGGAATTGAAATTGCAGAACTCAAAATTACGACCCCTTTGGTCGCATATGCGCCCAAAATTTTATCTATGCGAGCTTCACGCAGAATGCATATTTGCACTTAAAAACGGC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations