CRISPR

CRISPR1-cox17

ID
ZDB-CRISPR-190401-2
Name
CRISPR1-cox17
Previous Names
None
Target
Sequence
5' - GGCTTCACCTGCAGCGATAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hza2 cox17
hza3 cox17
Expression
Gene expression in Wild Types + CRISPR1-cox17
No data available
Phenotype
Phenotype resulting from CRISPR1-cox17
No data available
Phenotype of all Fish created by or utilizing CRISPR1-cox17
Phenotype Fish Conditions Figures
hatching decreased occurrence, abnormal cox17hza2/hza2 chemical treatment by environment: copper(2+) Fig. 6 from Zhang et al., 2018
hatching decreased occurrence, abnormal cox17hza2/hza2 chemical treatment by environment: copper atom Fig. 6 from Zhang et al., 2018
whole organism eaf1 expression decreased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 3 from Sun et al., 2019
swim bladder mesenchyme acta2 expression amount, ameliorated cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 7 from Sun et al., 2019
whole organism reactive oxygen species amount, abnormal cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 5 from Sun et al., 2019
whole organism sox2 expression amount, ameliorated cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 7 from Sun et al., 2019
whole organism anxa5b expression decreased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 7 from Sun et al., 2019
whole organism fgf10a expression increased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 7 from Sun et al., 2019
whole organism mnx1 expression amount, ameliorated cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 7 from Sun et al., 2019
whole organism mnx1 expression decreased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 7 from Sun et al., 2019
whole organism mt2 expression decreased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 3 from Sun et al., 2019
swim bladder bud pbx1a expression decreased amount, abnormal cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 7 from Sun et al., 2019
whole organism acta2 expression amount, ameliorated cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 7 from Sun et al., 2019
stress response to copper ion arrested, abnormal cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 5 from Sun et al., 2019
whole organism vps51 expression decreased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 3 from Sun et al., 2019
whole organism fgf10a expression increased amount, abnormal cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 7 from Sun et al., 2019
swim bladder mesenchyme acta2 expression increased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 7 from Sun et al., 2019
whole organism mnx1 expression increased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 7 from Sun et al., 2019
whole organism axin2 expression decreased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 4 from Sun et al., 2019
whole organism sco1 expression decreased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 3 from Sun et al., 2019
whole organism wnt7ba expression decreased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 4 from Sun et al., 2019
hemoglobin biosynthetic process occurrence, abnormal cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 5 from Sun et al., 2019
whole organism rad51 expression decreased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 3 from Sun et al., 2019
whole organism mnx1 expression decreased amount, abnormal cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 7 from Sun et al., 2019
swim bladder mesothelial cell anxa5b expression decreased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 7 from Sun et al., 2019
whole organism anxa5b expression decreased amount, abnormal cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 7 from Sun et al., 2019
whole organism sox2 expression increased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 7 from Sun et al., 2019
whole organism pbx1a expression amount, ameliorated cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 7 from Sun et al., 2019
whole organism hprt1l expression decreased amount, abnormal cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 7 from Sun et al., 2019
whole organism hprt1l expression decreased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 7 from Sun et al., 2019
whole organism pbx1a expression increased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 7 from Sun et al., 2019
swim bladder mesothelial cell anxa5b expression decreased amount, abnormal cox17hza2/hza2 (AB) chemical treatment by environment: copper(2+) Fig. 7 from Sun et al., 2019
whole organism tert expression increased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 3 from Sun et al., 2019
whole organism acta2 expression increased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 7 from Sun et al., 2019
whole organism sfrp1b expression decreased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 4 from Sun et al., 2019
whole organism wnt3 expression decreased amount, abnormal cox17hza2/hza2 (AB) standard conditions Fig. 4 from Sun et al., 2019
intestinal epithelial cell mitochondrial inner membrane swollen, abnormal cox17hza3/hza3 control Fig. 5 from Zhao et al., 2019
whole organism hspa5 expression increased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 5 from Zhao et al., 2019
intestine slc15a1b expression decreased amount, abnormal cox17hza3/hza3 control Fig. 5 from Zhao et al., 2019
retina opn1sw1 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 6 with image from Zhao et al., 2020
whole organism opn1lw1 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper(2+) Fig. 6 with image from Zhao et al., 2020
retina opn1lw1 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper(2+) Fig. 6 with image from Zhao et al., 2020
whole organism cyp3a65 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 5 from Zhao et al., 2019
whole organism slc15a1b expression decreased amount, abnormal cox17hza3/hza3 control Fig. 5 from Zhao et al., 2019
whole organism cyp8b1 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 5 from Zhao et al., 2019
whole organism opn1sw1 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 6 with image from Zhao et al., 2020
whole organism eif2ak3 expression increased amount, abnormal cox17hza3/hza3 chemical treatment: copper(2+) Fig. 6 with image from Zhao et al., 2020
whole organism slc15a1b expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 5 from Zhao et al., 2019
retina opn1lw1 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 6 with image from Zhao et al., 2020
retina mitochondrion swollen, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 6 with image from Zhao et al., 2020
whole organism cox4i2 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 6 with image from Zhao et al., 2020
intestinal epithelial cell endoplasmic reticulum structure, exacerbated cox17hza3/hza3 chemical treatment: copper atom Fig. 5 from Zhao et al., 2019
whole organism loxa expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 6 with image from Zhao et al., 2020
intestinal epithelial cell mitochondrial inner membrane swollen, exacerbated cox17hza3/hza3 chemical treatment: copper(2+) Fig. 5 from Zhao et al., 2019
whole organism cox4i2 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper(2+) Fig. 6 with image from Zhao et al., 2020
retina mitochondrion swollen, abnormal cox17hza3/hza3 chemical treatment: copper(2+) Fig. 6 with image from Zhao et al., 2020
whole organism opn1lw1 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 6 with image from Zhao et al., 2020
whole organism fabp2 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 5 from Zhao et al., 2019
whole organism atf6 expression increased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 6 with image from Zhao et al., 2020
whole organism loxa expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper(2+) Fig. 6 with image from Zhao et al., 2020
whole organism atf6 expression increased amount, abnormal cox17hza3/hza3 chemical treatment: copper(2+) Fig. 6 with image from Zhao et al., 2020
retina opn1sw1 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper(2+) Fig. 6 with image from Zhao et al., 2020
intestine fabp2 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 5 from Zhao et al., 2019
whole organism opn1lw1 expression decreased amount, abnormal cox17hza3/hza3 control Fig. 6 with image from Zhao et al., 2020
whole organism rho expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper(2+) Fig. 6 with image from Zhao et al., 2020
retina opn1sw1 expression decreased amount, abnormal cox17hza3/hza3 control Fig. 6 with image from Zhao et al., 2020
intestine fabp2 expression decreased amount, abnormal cox17hza3/hza3 control Fig. 5 from Zhao et al., 2019
retina opn1lw1 expression decreased amount, abnormal cox17hza3/hza3 control Fig. 6 with image from Zhao et al., 2020
whole organism opn1sw1 expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper(2+) Fig. 6 with image from Zhao et al., 2020
whole organism opn1sw1 expression decreased amount, abnormal cox17hza3/hza3 control Fig. 6 with image from Zhao et al., 2020
whole organism eif2ak3 expression increased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 6 with image from Zhao et al., 2020
intestinal epithelial cell endoplasmic reticulum structure, exacerbated cox17hza3/hza3 chemical treatment: copper(2+) Fig. 5 from Zhao et al., 2019
whole organism rho expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 6 with image from Zhao et al., 2020
whole organism ern1 expression increased amount, abnormal cox17hza3/hza3 chemical treatment: copper(2+) Fig. 6 with image from Zhao et al., 2020
whole organism cyp3a65 expression decreased amount, abnormal cox17hza3/hza3 control Fig. 5 from Zhao et al., 2019
whole organism znrf2a expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 6 with image from Zhao et al., 2020
whole organism rho expression decreased amount, abnormal cox17hza3/hza3 control Fig. 6 with image from Zhao et al., 2020
intestinal epithelial cell mitochondrial inner membrane swollen, exacerbated cox17hza3/hza3 chemical treatment: copper atom Fig. 5 from Zhao et al., 2019
whole organism ern1 expression increased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 6 with image from Zhao et al., 2020
whole organism hspa5 expression decreased amount, abnormal cox17hza3/hza3 control Fig. 5 from Zhao et al., 2019
intestinal epithelial cell endoplasmic reticulum loose, abnormal cox17hza3/hza3 control Fig. 5 from Zhao et al., 2019
whole organism znrf2a expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper(2+) Fig. 6 with image from Zhao et al., 2020
intestine slc15a1b expression decreased amount, abnormal cox17hza3/hza3 chemical treatment: copper atom Fig. 5 from Zhao et al., 2019
whole organism cox17 expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 1Fig. 2 from Sun et al., 2019
whole organism eaf1 expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 3 from Sun et al., 2019
swim bladder mesenchyme acta2 expression amount, ameliorated cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 6 from Sun et al., 2019
whole organism sox2 expression amount, ameliorated cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 6 from Sun et al., 2019
whole organism anxa5b expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 6 from Sun et al., 2019
whole organism fgf10a expression increased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 6 from Sun et al., 2019
whole organism reactive oxygen species amount, abnormal cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 5 from Sun et al., 2019
whole organism mnx1 expression amount, ameliorated cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 6 from Sun et al., 2019
developmental growth delayed, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 1 from Sun et al., 2019
whole organism mnx1 expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 6 from Sun et al., 2019
whole organism apoob expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 2 from Sun et al., 2019
whole organism mt2 expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 3 from Sun et al., 2019
whole organism acta2 expression amount, ameliorated cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 6 from Sun et al., 2019
swim bladder bud pbx1a expression decreased amount, abnormal cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 6 from Sun et al., 2019
whole organism vps51 expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 3 from Sun et al., 2019
stress response to copper ion arrested, abnormal cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 5 from Sun et al., 2019
whole organism mnx1 expression increased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 6 from Sun et al., 2019
swim bladder mesenchyme acta2 expression increased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 6 from Sun et al., 2019
whole organism axin2 expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 4 from Sun et al., 2019
whole organism sco1 expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 3 from Sun et al., 2019
whole organism wnt7ba expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 4 from Sun et al., 2019
hemoglobin biosynthetic process occurrence, abnormal cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 5 from Sun et al., 2019
whole organism rad51 expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 3 from Sun et al., 2019
whole organism mnx1 expression decreased amount, abnormal cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 6 from Sun et al., 2019
whole organism anxa5b expression decreased amount, abnormal cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 6 from Sun et al., 2019
swim bladder mesothelial cell anxa5b expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 6 from Sun et al., 2019
whole organism sox2 expression increased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 6 from Sun et al., 2019
whole organism zgc:152891 expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 2 from Sun et al., 2019
whole organism fgf10a expression amount, ameliorated cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 6 from Sun et al., 2019
whole organism ruvbl2 expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 2 from Sun et al., 2019
whole organism pbx1a expression amount, ameliorated cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 6 from Sun et al., 2019
whole organism hprt1l expression decreased amount, abnormal cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 6 from Sun et al., 2019
whole organism hprt1l expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 6 from Sun et al., 2019
whole organism pbx1a expression increased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 6 from Sun et al., 2019
swim bladder mesothelial cell anxa5b expression decreased amount, abnormal cox17hza3/hza3 (AB) chemical treatment by environment: copper(2+) Fig. 6 from Sun et al., 2019
whole organism tert expression increased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 3 from Sun et al., 2019
whole organism sfrp1b expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 4 from Sun et al., 2019
whole organism acta2 expression increased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 6 from Sun et al., 2019
whole organism wnt3 expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 4 from Sun et al., 2019
whole organism apool expression decreased amount, abnormal cox17hza3/hza3 (AB) standard conditions Fig. 2 from Sun et al., 2019
Citations