ZFIN ID: ZDB-CRISPR-190123-2
CRISPR Name: CRISPR3-npc1
Target: npc1 (1)
Source:
Target Sequence:
5' - GGCCAGCACTGTATCTGGTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR3-npc1 No data available
GENOMIC FEATURES CREATED WITH CRISPR3-npc1
Genomic Feature Affected Genomic Regions    
ihb334 npc1    
ihb335 npc1    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR3-npc1 No data available
PHENOTYPE
Phenotype resulting from CRISPR3-npc1
No data available

Phenotype of all Fish created by or utilizing CRISPR3-npc1
Phenotype Fish Conditions Figures
locomotory behavior process quality, abnormal npc1ihb334/ihb334 standard conditions Fig. S Movie 1 from Lin et al., 2018
cerebellum Purkinje cell decreased amount, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
hepatocyte vacuolated, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
whole organism dead, abnormal npc1ihb334/ihb334 standard conditions Fig. 2 from Lin et al., 2018
hepatocyte morphology, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
whole organism decreased life span, abnormal npc1ihb334/ihb334 standard conditions Fig. 2 from Lin et al., 2018
liver sphingolipid increased amount, abnormal npc1ihb334/ihb334 standard conditions Fig. 4 from Lin et al., 2018
whole organism decreased length, abnormal npc1ihb334/ihb334 standard conditions Fig. 2 from Lin et al., 2018
liver fatty, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
liver cholesterol increased amount, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
locomotory behavior process quality, abnormal npc1ihb335/ihb335 standard conditions Fig. S Movie 1 from Lin et al., 2018
whole organism dead, abnormal npc1ihb335/ihb335 standard conditions Fig. 2 from Lin et al., 2018
whole organism decreased life span, abnormal npc1ihb335/ihb335 standard conditions Fig. 2 from Lin et al., 2018
liver sphingolipid increased amount, abnormal npc1ihb335/ihb335 standard conditions Fig. 4 from Lin et al., 2018
whole organism decreased length, abnormal npc1ihb335/ihb335 standard conditions Fig. 2 from Lin et al., 2018
OTHER CRISPR3-npc1 CRISPR PAGESNo links to external sites
CITATIONS (2)