CRISPR

CRISPR3-npc1

ID
ZDB-CRISPR-190123-2
Name
CRISPR3-npc1
Previous Names
None
Target
Sequence
5' - GGCCAGCACTGTATCTGGTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb334 npc1
ihb335 npc1
Expression
Gene expression in Wild Types + CRISPR3-npc1
No data available
Phenotype
Phenotype resulting from CRISPR3-npc1
No data available
Phenotype of all Fish created by or utilizing CRISPR3-npc1
Phenotype Fish Conditions Figures
locomotory behavior process quality, abnormal npc1ihb334/ihb334 standard conditions Fig. S Movie 1 from Lin et al., 2018
cerebellum Purkinje cell decreased amount, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
hepatocyte vacuolated, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
whole organism dead, abnormal npc1ihb334/ihb334 standard conditions Fig. 2 from Lin et al., 2018
hepatocyte morphology, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
whole organism decreased life span, abnormal npc1ihb334/ihb334 standard conditions Fig. 2 from Lin et al., 2018
liver sphingolipid increased amount, abnormal npc1ihb334/ihb334 standard conditions Fig. 4 from Lin et al., 2018
whole organism decreased length, abnormal npc1ihb334/ihb334 standard conditions Fig. 2 from Lin et al., 2018
liver fatty, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
liver cholesterol increased amount, abnormal npc1ihb334/ihb334 standard conditions Fig. 3 from Lin et al., 2018
locomotory behavior process quality, abnormal npc1ihb335/ihb335 standard conditions Fig. S Movie 1 from Lin et al., 2018
whole organism dead, abnormal npc1ihb335/ihb335 standard conditions Fig. 2 from Lin et al., 2018
whole organism decreased life span, abnormal npc1ihb335/ihb335 standard conditions Fig. 2 from Lin et al., 2018
liver sphingolipid increased amount, abnormal npc1ihb335/ihb335 standard conditions Fig. 4 from Lin et al., 2018
whole organism decreased length, abnormal npc1ihb335/ihb335 standard conditions Fig. 2 from Lin et al., 2018
Citations