ZFIN ID: ZDB-CRISPR-190115-1
CRISPR Name: CRISPR3-kita
Target: kita (1)
Previous Name: #2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GAATTACCCCAGAAGGTCCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The "GA" at the beginning is not present in the genomic sequence.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR3-kita No data available
GENOMIC FEATURES CREATED WITH CRISPR3-kitaNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR3-kita No data available
PHENOTYPE
Phenotype resulting from CRISPR3-kita
No data available

Phenotype of all Fish created by or utilizing CRISPR3-kita
No data available
OTHER CRISPR3-kita CRISPR PAGESNo links to external sites
CITATIONS (1)