header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-190110-1
CRISPR Name: CRISPR1-jag2b
Target: jag2b (1)
Source:
Target Sequence:
5' - GGGGTCCCTGGCAGAAGGCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-jag2b No data available
GENOMIC FEATURES CREATED WITH CRISPR1-jag2b
Genomic Feature Affected Genomic Regions    
ihb328 jag2b    
ihb331 jag2b    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-jag2b No data available
PHENOTYPE
Phenotype resulting from CRISPR1-jag2b
No data available

Phenotype of all Fish created by or utilizing CRISPR1-jag2b
No data available
OTHER CRISPR1-jag2b CRISPR PAGES No links to external sites
CITATIONS (2)