CRISPR

CRISPR1-dnaaf2

ID
ZDB-CRISPR-190103-1
Name
CRISPR1-dnaaf2
Previous Names
None
Target
Sequence
5' - GGAGATCCGGCCACAGCTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ja104 dnaaf2
Expression
Gene expression in Wild Types + CRISPR1-dnaaf2
No data available
Phenotype
Phenotype resulting from CRISPR1-dnaaf2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-dnaaf2
Phenotype Fish Conditions Figures
sperm axoneme Ab1-dnali1 labeling decreased amount, abnormal dnaaf2ja104/ja104 standard conditions Fig. 4 with image from Yamaguchi et al., 2018
sperm inner dynein arm decreased amount, abnormal dnaaf2ja104/ja104 standard conditions Fig. 3 with image from Yamaguchi et al., 2018
heart looping process quality, abnormal dnaaf2ja104/ja104 standard conditions Fig. 5 with image from Yamaguchi et al., 2018
Kupffer's vesicle cilium movement process quality, abnormal dnaaf2ja104/ja104 standard conditions Fig. 5 with image from Yamaguchi et al., 2018
flagellated sperm motility process quality, abnormal pih1d2ja103/ja103 ; dnaaf2ja104/ja104 standard conditions Fig. 2 from Yamaguchi et al., 2018
sperm axoneme Ab1-dnah5l labeling decreased amount, abnormal pih1d2ja103/ja103 ; dnaaf2ja104/ja104 standard conditions Fig. 4 with image from Yamaguchi et al., 2018
sperm axoneme Ab1-dnai1 labeling decreased amount, abnormal pih1d2ja103/ja103 ; dnaaf2ja104/ja104 standard conditions Fig. 4 with image from Yamaguchi et al., 2018
sperm sperm flagellum Ab1-dnah5l labeling decreased distribution, abnormal pih1d2ja103/ja103 ; dnaaf2ja104/ja104 standard conditions Fig. 4 with image from Yamaguchi et al., 2018
sperm sperm flagellum Ab1-dnah5l labeling spatial pattern, abnormal pih1d2ja103/ja103 ; dnaaf2ja104/ja104 standard conditions Fig. 4 with image from Yamaguchi et al., 2018
Kupffer's vesicle cilium immobile, abnormal pih1d2ja103/ja103 ; dnaaf2ja104/ja104 standard conditions Fig. 5 with image from Yamaguchi et al., 2018
heart looping process quality, abnormal pih1d2ja103/ja103 ; dnaaf2ja104/ja104 standard conditions Fig. 5 with image from Yamaguchi et al., 2018
sperm axonemal dynein complex composition, abnormal pih1d2ja103/ja103 ; dnaaf2ja104/ja104 standard conditions Fig. 3 with image from Yamaguchi et al., 2018
sperm distal side immobile, abnormal pih1d2ja103/ja103 ; dnaaf2ja104/ja104 standard conditions Fig. 2 from Yamaguchi et al., 2018
sperm axoneme Ab1-dnali1 labeling decreased amount, abnormal pih1d2ja103/ja103 ; dnaaf2ja104/ja104 standard conditions Fig. 4 with image from Yamaguchi et al., 2018
sperm cellular motility, abnormal pih1d2ja103/ja103 ; dnaaf2ja104/ja104 standard conditions Fig. 2 from Yamaguchi et al., 2018
Citations