header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-181205-3
CRISPR Name: CRISPR14-slc45a2
Target: slc45a2 (1)
Previous Name: drslc45a2_sg2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGGGTCGGCCATGTTTGGAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The first G at the beginning is not present in the genome sequence.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR14-slc45a2 No data available
GENOMIC FEATURES CREATED WITH CRISPR14-slc45a2 No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR14-slc45a2 No data available
PHENOTYPE
Phenotype resulting from CRISPR14-slc45a2
No data available

Phenotype of all Fish created by or utilizing CRISPR14-slc45a2
No data available
OTHER CRISPR14-slc45a2 CRISPR PAGES No links to external sites
CITATIONS (1)