ZFIN ID: ZDB-CRISPR-181119-23
CRISPR Name: CRISPR1-nfe2
Target: nfe2 (2)
Previous Name: Z001440 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGAGATGGACTTGGCCTGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-nfe2 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-nfe2No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-nfe2 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-nfe2
No data available

Phenotype of all Fish created by or utilizing CRISPR1-nfe2
No data available
OTHER CRISPR1-nfe2 CRISPR PAGES
  • CRISPRz:Z001440 (1)
  • CITATIONS (2)