ZFIN ID: ZDB-CRISPR-181119-19
CRISPR Name: CRISPR2-gata1a
Target: gata1a (2)
Previous Name: Z001436 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGTTCATCTACATCAACGGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-gata1a No data available
GENOMIC FEATURES CREATED WITH CRISPR2-gata1a No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-gata1a No data available
PHENOTYPE
Phenotype resulting from CRISPR2-gata1a
No data available

Phenotype of all Fish created by or utilizing CRISPR2-gata1a
No data available
Genome Resources: CRISPRz:Z001436 (1)
CITATIONS (2)