ZFIN ID: ZDB-CRISPR-181010-10
CRISPR Name: CRISPR8-s1pr2
Target: s1pr2 (1)
Source:
Target Sequence:
5' - GTGTCCAGTGGTTCATACGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The "G" at the 5' end was added presumably to increase binding.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR8-s1pr2 No data available
GENOMIC FEATURES CREATED WITH CRISPR8-s1pr2No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR8-s1pr2 No data available
PHENOTYPE
Phenotype resulting from CRISPR8-s1pr2
No data available

Phenotype of all Fish created by or utilizing CRISPR8-s1pr2
No data available
OTHER CRISPR8-s1pr2 CRISPR PAGESNo links to external sites
CITATIONS (1)