CRISPR

CRISPR1-alx1

ID

ZDB-CRISPR-181010-1

Name

CRISPR1-alx1

Previous Names

None

Target

alx1 (1)

Sequence

5' - GGAGAGCAGCCTGCACGCGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
co3002	alx1
uw2016	alx1

Expression

Gene expression in Wild Types + CRISPR1-alx1

No data available

Phenotype

Phenotype resulting from CRISPR1-alx1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-alx1

Phenotype	Fish	Conditions	Figures
eye morphology, abnormal	alx1^{uw2016/uw2016}	standard conditions	Fig. 1 , Fig. 8 from Yoon et al., 2022
chondrocranium morphology, abnormal	alx1^{uw2016/uw2016}	chemical treatment by environment: ethanol	Fig. 8 from Yoon et al., 2022
chondrocranium morphology, abnormal	alx1^{uw2016/uw2016}	control	Fig. 8 from Yoon et al., 2022
eye morphology, abnormal	alx1^{uw2016/uw2016}	chemical treatment by environment: ethanol	Fig. 8 from Yoon et al., 2022
lens capsule structure, abnormal	alx1^{uw2016/uw2016}	standard conditions	Fig. 1 from Yoon et al., 2022
annular ligament absent, abnormal	alx1^{uw2016/uw2016}	standard conditions	Fig. 1 from Yoon et al., 2022
lens absent, abnormal	alx1^{uw2016/uw2016}	standard conditions	Fig. 1 from Yoon et al., 2022
eye col2a1a expression absent, abnormal	alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
eye nucleate erythrocyte increased distribution, abnormal	alx1^{uw2016/uw2016}	standard conditions	Fig. 3 from Yoon et al., 2022
chondrocranium cartilage chondrocyte cuboid, abnormal	alx1^{uw2016/uw2016} (NHGRI-1)	standard conditions	Fig. 6 from Pini et al., 2020
whole organism alx3 expression increased amount, abnormal	alx1^{uw2016/uw2016} (NHGRI-1)	standard conditions	Fig. 6 from Pini et al., 2020
embryonic neurocranium morphogenesis process quality, abnormal	alx1^{uw2016/uw2016} (NHGRI-1)	standard conditions	Fig. 6 from Pini et al., 2020
Meckel's cartilage decreased size, abnormal	alx1^{uw2016/uw2016} (NHGRI-1)	standard conditions	Fig. 6 from Pini et al., 2020
whole organism alx4a expression increased amount, abnormal	alx1^{uw2016/uw2016} (NHGRI-1)	standard conditions	Fig. 6 from Pini et al., 2020
whole organism alx1 expression decreased amount, abnormal	alx1^{uw2016/uw2016} (NHGRI-1)	standard conditions	Fig. 6 from Pini et al., 2020
ethmoid cartilage morphology, abnormal	alx1^{uw2016/uw2016} (NHGRI-1)	standard conditions	Fig. 6 from Pini et al., 2020
ethmoid cartilage decreased size, abnormal	alx1^{uw2016/uw2016} (NHGRI-1)	standard conditions	Fig. 6 from Pini et al., 2020
chondrocranium cartilage morphology, abnormal	alx1^{uw2016/uw2016} (NHGRI-1)	standard conditions	Fig. 6 from Pini et al., 2020
chondrocranium morphology, abnormal	alx1^uw2016/+	chemical treatment by environment: ethanol	Fig. 8 from Yoon et al., 2022
chondrocranium morphology, abnormal	alx1^uw2016/+	control	Fig. 8 from Yoon et al., 2022
chondrocranium neural crest cell migration decreased process quality, abnormal	alx1^{uw2016/uw2016}; zf393Tg + CRISPR3-alx3	control	Fig. 6 from Yoon et al., 2022
ethmoid cartilage col2a1a expression absent, abnormal	alx3^uw2113/+; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
eye nucleate erythrocyte increased distribution, abnormal	alx3^uw2113/+; alx1^{uw2016/uw2016}	standard conditions	Fig. 3 from Yoon et al., 2022
eye morphology, abnormal	alx3^uw2113/+; alx1^{uw2016/uw2016}	standard conditions	Fig. 3 from Yoon et al., 2022
lateral ethmoid decreased size, abnormal	alx3^uw2113/+; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
ethmoid cartilage absent, abnormal	alx3^uw2113/+; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
eye col2a1a expression absent, abnormal	alx3^uw2113/+; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
ethmoid cartilage decreased size, abnormal	alx3^uw2113/+; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
lateral ethmoid absent, abnormal	alx3^uw2113/+; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
ventral mandibular arch protruding, abnormal	alx3^uw2113/+; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
chondrocranium shortened, abnormal	alx3^uw2113/+; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
chondrocranium col2a1a expression decreased distribution, abnormal	alx3^uw2113/+; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
ethmoid cartilage col2a1a expression absent, abnormal	alx3^{uw2113/uw2113}; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
eye morphology, abnormal	alx3^{uw2113/uw2113}; alx1^{uw2016/uw2016}	standard conditions	Fig. 3 from Yoon et al., 2022
eye nucleate erythrocyte increased distribution, abnormal	alx3^{uw2113/uw2113}; alx1^{uw2016/uw2016}	standard conditions	Fig. 3 from Yoon et al., 2022
ethmoid cartilage absent, abnormal	alx3^{uw2113/uw2113}; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
lateral ethmoid decreased size, abnormal	alx3^{uw2113/uw2113}; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
eye col2a1a expression absent, abnormal	alx3^{uw2113/uw2113}; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
ethmoid cartilage decreased size, abnormal	alx3^{uw2113/uw2113}; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
lateral ethmoid absent, abnormal	alx3^{uw2113/uw2113}; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
ventral mandibular arch protruding, abnormal	alx3^{uw2113/uw2113}; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
chondrocranium shortened, abnormal	alx3^{uw2113/uw2113}; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022
chondrocranium col2a1a expression decreased distribution, abnormal	alx3^{uw2113/uw2113}; alx1^{uw2016/uw2016}	standard conditions	Fig. 2 from Yoon et al., 2022

Citations