header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-180827-8
CRISPR Name: CRISPR1-nkx2.4b
Target: nkx2.4b (1)
Source:
Target Sequence:
5' - GTTCGAGCCGTACCAAGCCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-nkx2.4b No data available
GENOMIC FEATURES CREATED WITH CRISPR1-nkx2.4b No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-nkx2.4b No data available
PHENOTYPE
Phenotype resulting from CRISPR1-nkx2.4b
No data available

Phenotype of all Fish created by or utilizing CRISPR1-nkx2.4b
No data available
OTHER CRISPR1-nkx2.4b CRISPR PAGES No links to external sites
CITATIONS (1)