CRISPR

CRISPR6-rela

ID

ZDB-CRISPR-180517-1

Name

CRISPR6-rela

Previous Names

None

Target

rela (1)

Sequence

5' - GGCTGATGTGCACCGGCAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ihb651	rela
ihb652	rela

Expression

Gene expression in Wild Types + CRISPR6-rela

No data available

Phenotype

Phenotype resulting from CRISPR6-rela

No data available

Phenotype of all Fish created by or utilizing CRISPR6-rela

Phenotype	Fish	Conditions	Figures
kidney cxcl8b.1 expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 7 from Ouyang et al., 2020
whole organism mxc expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 4 from Ouyang et al., 2020
liver cxcl8a expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Ouyang et al., 2020
whole organism cxcl8b.1 expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 4 from Ouyang et al., 2020
liver ifnphi1 expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Ouyang et al., 2020
whole organism ventral region hemorrhagic, exacerbated	rela^{ihb651/ihb651} (AB)	viral treatment by injection: Sprivivirus cyprinus	Fig. 5 from Ouyang et al., 2020
kidney necrotic, exacerbated	rela^{ihb651/ihb651} (AB)	viral treatment by injection: Sprivivirus cyprinus	Fig. 5 from Ouyang et al., 2020
whole organism tnfa expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 4 from Ouyang et al., 2020
liver il1b expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Ouyang et al., 2020
liver il10 expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Ouyang et al., 2020
whole organism tnfb expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 4 from Ouyang et al., 2020
pleuroperitoneal region swollen, exacerbated	rela^{ihb651/ihb651} (AB)	viral treatment by injection: Sprivivirus cyprinus	Fig. 5 from Ouyang et al., 2020
whole organism il1b expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 4 from Ouyang et al., 2020
whole organism pkz expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 4 from Ouyang et al., 2020
whole organism il6 expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 4 from Ouyang et al., 2020
liver il6 expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Ouyang et al., 2020
liver mxc expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Ouyang et al., 2020
kidney tnfa expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 7 from Ouyang et al., 2020
liver cxcl8b.1 expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Ouyang et al., 2020
kidney il1b expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 7 from Ouyang et al., 2020
kidney mxc expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 7 from Ouyang et al., 2020
kidney il6 expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 7 from Ouyang et al., 2020
whole organism cxcl8a expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 4 from Ouyang et al., 2020
kidney tnfb expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 7 from Ouyang et al., 2020
liver pkz expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Ouyang et al., 2020
whole organism il10 expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 4 from Ouyang et al., 2020
liver tnfb expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Ouyang et al., 2020
defense response to virus disrupted, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 3 from Ouyang et al., 2020
liver tnfa expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 6 from Ouyang et al., 2020
liver necrotic, exacerbated	rela^{ihb651/ihb651} (AB)	viral treatment by injection: Sprivivirus cyprinus	Fig. 5 from Ouyang et al., 2020
whole organism viability, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 3 from Ouyang et al., 2020
whole organism ifnphi1 expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 4 from Ouyang et al., 2020
kidney ifnphi1 expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 7 from Ouyang et al., 2020
kidney cxcl8a expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 7 from Ouyang et al., 2020
kidney il10 expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 7 from Ouyang et al., 2020
kidney pkz expression decreased amount, abnormal	rela^{ihb651/ihb651} (AB)	viral treatment by exposure to environment: Sprivivirus cyprinus	Fig. 7 from Ouyang et al., 2020

Citations