ZFIN ID: ZDB-CRISPR-180510-10
CRISPR Name: CRISPR35-tyr
Target: tyr (1)
Source:
Target Sequence:
5' - TTCGTGTGGATGCATTATTACGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR35-tyr No data available
GENOMIC FEATURES CREATED WITH CRISPR35-tyrNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR35-tyr No data available
PHENOTYPE
Phenotype resulting from CRISPR35-tyr
No data available

Phenotype of all Fish created by or utilizing CRISPR35-tyr
No data available
OTHER CRISPR35-tyr CRISPR PAGESNo links to external sites
CITATIONS (1)