ZFIN ID: ZDB-CRISPR-180503-2
CRISPR Name: CRISPR1-nid1a
Target: nid1a (1)
Previous Name: CRISPR-nid1a

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Source:
Target Sequence:
5' - GGATTAACGTTGTCTGTCAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-nid1a No data available
GENOMIC FEATURES CREATED WITH CRISPR1-nid1a
Genomic Feature Affected Genomic Regions    
zju115 nid1a    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-nid1a No data available
PHENOTYPE
Phenotype resulting from CRISPR1-nid1a
No data available

Phenotype of all Fish created by or utilizing CRISPR1-nid1a
Genome Resources:
CITATIONS (1)