CRISPR

CRISPR1-cdc6

ID
ZDB-CRISPR-180327-1
Name
CRISPR1-cdc6
Previous Names
None
Target
Sequence
5' - GGAGCGCAGCGCTGCTTAGGGGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
tsu21cd cdc6
tsu7cd cdc6
Expression
Gene expression in Wild Types + CRISPR1-cdc6
No data available
Phenotype
Phenotype resulting from CRISPR1-cdc6
No data available
Phenotype of all Fish created by or utilizing CRISPR1-cdc6
Phenotype Fish Conditions Figures
central nervous system cdc6 expression decreased amount, abnormal cdc6tsu7cd/tsu7cd standard conditions Fig. 2 from Yao et al., 2017
central nervous system cdc6 expression absent, abnormal cdc6tsu7cd/tsu7cd standard conditions Fig. 2 from Yao et al., 2017
head morphology, abnormal cdc6tsu21cd/tsu21cd standard conditions Fig. 6 from Yao et al., 2017
intestine morphology, abnormal cdc6tsu21cd/tsu21cd standard conditions Fig. 6 from Yao et al., 2017
testis decreased size, abnormal cdc6tsu21cd/tsu21cd standard conditions Fig. 6 from Yao et al., 2017
eating behavior disrupted, abnormal cdc6tsu21cd/tsu21cd standard conditions text only from Yao et al., 2017
swimming decreased rate, abnormal cdc6tsu21cd/tsu21cd standard conditions text only from Yao et al., 2017
whole organism morphology, abnormal cdc6tsu21cd/tsu21cd standard conditions Fig. 6 from Yao et al., 2017
liver morphology, abnormal cdc6tsu21cd/tsu21cd standard conditions Fig. 6 from Yao et al., 2017
growth decreased occurrence, abnormal cdc6tsu21cd/tsu21cd standard conditions Fig. 6 from Yao et al., 2017
whole organism decreased length, abnormal cdc6tsu21cd/tsu21cd standard conditions Fig. 6 from Yao et al., 2017
swim bladder morphology, abnormal cdc6tsu21cd/tsu21cd standard conditions Fig. 6 from Yao et al., 2017
whole organism decreased size, abnormal cdc6tsu21cd/tsu21cd standard conditions Fig. 6 from Yao et al., 2017
mouth morphology, abnormal cdc6tsu21cd/tsu21cd standard conditions Fig. 6 from Yao et al., 2017
spinal cord morphology, abnormal cdc6tsu21cd/tsu21cd standard conditions Fig. 6 from Yao et al., 2017
mating behavior process quality, abnormal cdc6tsu21cd/tsu21cd standard conditions Fig. 6 from Yao et al., 2017
whole organism decreased weight, abnormal cdc6tsu21cd/tsu21cd standard conditions Fig. 6 from Yao et al., 2017
Citations