ZFIN ID: ZDB-CRISPR-180314-3
CRISPR Name: CRISPR1-kita
Target: kita (1)
Source:
Target Sequence:
5' - GGCTGACCCAGTGTGATCGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-kita No data available
GENOMIC FEATURES CREATED WITH CRISPR1-kita
Genomic Feature Affected Genomic Regions    
ihb213 kita    
ihb214 kita    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-kita No data available
PHENOTYPE
Phenotype resulting from CRISPR1-kita
No data available

Phenotype of all Fish created by or utilizing CRISPR1-kita
No data available
OTHER CRISPR1-kita CRISPR PAGESNo links to external sites
CITATIONS (1)