ZFIN ID: ZDB-CRISPR-180213-425
CRISPR Name: CRISPR1-aftpha
Target: aftpha (1)
Source:
Target Sequence:
5' - TGTGATGTGAGCTTGATGCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-aftpha No data available
GENOMIC FEATURES CREATED WITH CRISPR1-aftpha
Genomic Feature Affected Genomic Regions    
zko1115a aftpha    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-aftpha No data available
PHENOTYPE
Phenotype resulting from CRISPR1-aftpha
No data available

Phenotype of all Fish created by or utilizing CRISPR1-aftpha
No data available
Genome Resources:
CITATIONS (1)