ZFIN ID: ZDB-CRISPR-180213-333
CRISPR Name: CRISPR1-kpna3
Target: kpna3 (1)
Source:
Target Sequence:
5' - GAGTCTGGAGGACTCTGACG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-kpna3 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-kpna3
Genomic Feature Affected Genomic Regions    
zko910a kpna3    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-kpna3 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-kpna3
No data available

Phenotype of all Fish created by or utilizing CRISPR1-kpna3
No data available
OTHER CRISPR1-kpna3 CRISPR PAGESNo links to external sites
CITATIONS (1)