ZFIN ID: ZDB-CRISPR-180213-23
CRISPR Name: CRISPR1-jam2a
Target: jam2a (1)
Source:
Target Sequence:
5' - GGTGGCGTTGGGATGGCGGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-jam2a No data available
GENOMIC FEATURES CREATED WITH CRISPR1-jam2a
Genomic Feature Affected Genomic Regions    
zko30a jam2a    
zko30b jam2a    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-jam2a No data available
PHENOTYPE
Phenotype resulting from CRISPR1-jam2a
No data available

Phenotype of all Fish created by or utilizing CRISPR1-jam2a
No data available
Genome Resources:
CITATIONS (1)